) fat (B) compared with chow. Entire body glucose turnover was reduced 200 by saturated fat feeding (C). Basal hepatic glucose production was not different, but insulin’s ability to suppress hepatic glucose production was impaired in both manage and TLR-4 eficient mice fed saturated fat compared with chow (D and E). n = 72 per group. *P 0.05.MethodsAnimals. Sprague-Dawley rats (180 g) were bought from Charles River, C57/ BL6, 10ScSnJ (stock 000476); 10ScNJ (stock 003752) mice have been purchased from Jackson Laboratories at ten and 7 wk of age, respectively. All animals have been males. The animals were housed at Yale University College of Medicine and maintained in accordance with the Institutional Animal Care and Use Committee recommendations. Antisense oligonucleotides. Antisense oligonucleotides (ISIS Pharmaceuticals) were injected i.p. each and every other day for three wk just before experimentation. ASO sequences were TLR-4: CCACATTGAGTTTCTTTAAG and MyD88: TACACTTGACCCAGGTTGCT. Knockdown was in between 65 and 90 as validated by Western blotting and/or quantitative PCR. Diets. The unsaturated fat-rich safflower-based eating plan was 112245 from Dyets (0 myristate, five palmitate, 2 stearate, 12 oleate, 80 linoleate). The saturated fat-rich lard-based diet regime was D12492 from Research Diets (1 , myristate, 20 palmitate, 12 stearate, 34 oleate, 28 linoleate). Both diets contained 60 kcal from fat. Heavy cream contained 12 myristate, 31 palmitate, 11 stearate, 24 oleate, and three linoleate (molar ratio). Acute Rat Insulin Infusions. For acute insulin signaling experiments, catheterized rats were offered a primed (200 mU/kg) continuous (4 mU g-1 in-1) infusion of insulin (Novolin, Novo Nordisk) for 20 min. Hyperinsulinemic-Euglycemic Clamp. Have been performed as previously described (41). Briefly, following an overnight rapidly, catheterized mice were infused with 3-[3H]glucose at a rate of 0.05 Ci/min for 120 min to identify basal glucose turnover. Subsequent, a primed infusion of insulin and 3-[3H]glucose was administered at 7.14 mU g-1 in-1 and 0.24 Ci/min, respectively, for four min, following which the rates were reduced to three mU g-1 in-1 insulin and 0.1 Ci/min 3-[3H]glucose for the remainder in the experiment. Mean plateau insulin levels in mice have been between 40.7 and 42.five U/mL for all groups. Blood was collected via tail massage for plasma glucose, insulin, and tracer levels at set time points through the 140-min infusion, as well as a variable infusion of 20dextrose was provided to sustain euglycemia. A 10-Ci bolus injection of [14C]2deoxyglucose was offered at 90 min to identify tissue-specific glucose uptake.Telmisartan IPGGT.Tetrakis(triphenylphosphine)palladium Overnight fasted mice have been injected intraperitoneally with 1 mg/g glucose, and blood was collected by tail bleed at set times for plasma insulin and glucose measurements.PMID:24563649 Lard Gavage. Following an overnight fast, catheterized mice were given an oral gavage of lard (400 L/25 g body weight) and allowed to rest for six h. The mice had been then given a primed infusion of insulin (7.14 mU g-1 in-1) for four min, soon after which the rate was lowered (three mU g-1 in-1 insulin). Physique Composition and Metabolic Cage Research. Physique composition was determined by 1H magnetic resonance spectroscopy (Bruker Minispec). The complete laboratory animal monitoring method (Columbus Instruments) was used to evaluate activity, energy expenditure, feeding, drinking, and respiratory quotient over the course of 48 h. The data would be the 24-h averages normalized to physique weight. Quantitative PCR. RNA was isolated utilizing.
